Review



fkbpx1  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc fkbpx1
    Fkbpx1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fkbpx1/N118+nLV+EF-1a-Gal-FKBPx1-HA-PGK-Blast+(Plasmid+%2344245)/us11905537-1055-3-5
    Average 90 stars, based on 2 article reviews
    fkbpx1 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Bifunction chemical epigenetic modifiers and methods of use
    Article Snippet: .. Methods: Chemical Synthesis: See FIGS. 20A-D. Bifunctional CEMa compounds were diluted in DMSO (Sigma D2650) and kept dry at −20° C. Plasmid design: To construct dCas9-FKBPx1 and -FKBPx2, Addgene #61425 was digested at the BamHI and BsrG1 sites. .. To insert the FKBPx1 (from Addgene #44245) and FKBPx2 (from N160) fusion, In-Fusion (#639650) was used with the following primers: FKBPx1-Forward (SEQ ID NO: 15) (5′ GGCGGCCGCTGGATCCGGCGTGCAGGTGGAGACTAT), Reverse (SEQ ID NO: 16) (5′ CTCCACTGCCTGTACATTCCAGTTTTAGAAGCTCCACATC); FKBPx2-Forward (SEQ ID NO: 17) (5′ CTCCACTGCCTGTACATTCCAGTTTTAGAAGCTCCACATC), Reverse (SEQ ID NO: 18) (5′ GGCGGCCGCTGGATCCGGGGTCCAAGTTGAAACCATTA).

    Construct:

    Article Title: Bifunction chemical epigenetic modifiers and methods of use
    Article Snippet: .. Methods: Chemical Synthesis: See FIGS. 20A-D. Bifunctional CEMa compounds were diluted in DMSO (Sigma D2650) and kept dry at −20° C. Plasmid design: To construct dCas9-FKBPx1 and -FKBPx2, Addgene #61425 was digested at the BamHI and BsrG1 sites. .. To insert the FKBPx1 (from Addgene #44245) and FKBPx2 (from N160) fusion, In-Fusion (#639650) was used with the following primers: FKBPx1-Forward (SEQ ID NO: 15) (5′ GGCGGCCGCTGGATCCGGCGTGCAGGTGGAGACTAT), Reverse (SEQ ID NO: 16) (5′ CTCCACTGCCTGTACATTCCAGTTTTAGAAGCTCCACATC); FKBPx2-Forward (SEQ ID NO: 17) (5′ CTCCACTGCCTGTACATTCCAGTTTTAGAAGCTCCACATC), Reverse (SEQ ID NO: 18) (5′ GGCGGCCGCTGGATCCGGGGTCCAAGTTGAAACCATTA).



    Similar Products

    fkbpx1  (Addgene inc)
    90
    Addgene inc fkbpx1
    Fkbpx1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fkbpx1/N118+nLV+EF-1a-Gal-FKBPx1-HA-PGK-Blast+(Plasmid+%2344245)/us11905537-1055-3-5
    Average 90 stars, based on 1 article reviews
    fkbpx1 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    selection with blasticidin  (Addgene inc)
    90
    Addgene inc selection with blasticidin
    Selection With Blasticidin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/fkbpx1/N118+nLV+EF-1a-Gal-FKBPx1-HA-PGK-Blast+(Plasmid+%2344245)/pmc06608945-88-21-25
    Average 90 stars, based on 1 article reviews
    selection with blasticidin - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results